You are viewing the site in preview mode

Skip to main content

γδ T Cell Receptor Analysis Supports a Role for HSP 70 Selection of Lymphocytes in Multiple Sclerosis Lesions

Abstract

Background

Interactions between γδ T cells and heat shock proteins (HSP) have been proposed as contributing factors in a number of diseases of possible autoimmune etiology but definitive evidence to support this hypothesis has been lacking. In multiple sclerosis (MS), a chronic inflammatory neurologic disease, HSP and γδ T cells are known to colocalize in brain lesions. Analysis of T cell receptor (TCR) gene usage in these lesions has detected evidence of clonality within both the Vδ2-Jδ1 and Vδ2-Jδ3 populations of γδ T cells. In our own studies, using direct sequence analysis, a dominant Vδ2-Jδ3 TCR sequence was found in 9 MS brain samples, suggesting a response to a common antigen. In this report, we have examined γδ T cell receptor gene usage in MS peripheral blood T cell lines selected for reactivity to HSP 70.

Materials and Methods

TCR rearrangement patterns for Vδ2-Jδ1 and Vδ2-Jδ3 were studied using the polymerase chain reaction (PCR) and a direct sequencing technique in populations of peripheral blood mononuclear cells (PBMC) cultured with Mycobacterium tuberculosis (M. tuberculosis) purified protein derivative (PPD) and then selected for reactivity to a 70-kD heat shock protein (HSP70). Cells were obtained from healthy donors, patients with MS, and patients with tuberculosis (TB). PCR products were subjected to direct sequence analysis to look for evidence of clonality within these T cell lines and to define the sequence of the V-D-J (CDR3) region of the TCR.

Results

In freshly isolated PBMC, both Vδ2-Jδ1 and Vδ2-Jδ3 gene rearrangement patterns were detected, whereas in HSP70+ T cell lines the predominant δ chain rearrangement pattern was Vδ2-Jδ3. Direct sequence analyses indicated that in cells reactive with HSP70 the Vδ2-Jδ3 sequences were usually oligoclonal and used Dδ3 exclusively. In four of four MS and two of three TB patients, the oligoclonal sequences in the HSP70+ T cell lines were identical to one another and to a dominant sequence previously detected in MS brain lesions. In two of three HSP70+ T cell lines from healthy controls, the oligoclonal sequences differed from those found in both groups of patients but were identical to one another except for a small region of heterogeneity in the second N region. In contrast, in freshly isolated PBMC or in PPD+HSP70 T cell lines, the Vδ2-Jδ3 gene rearrangement patterns were usually polyclonal and dominant sequences were rarely identified.

Conclusions

These results support the conclusion that a subpopulation of γδ T cells in MS lesions are responding to HSP 70 and that non-CNS-specific antigens contribute to the pathogenesis of MS.

Introduction

Multiple sclerosis (MS) is a chronic debilitating disease of young adults in which the central nervous system (CNS) becomes the site of an immune attack upon the insulating membrane of nerve fibers, myelin, which is selectively destroyed. While the focus of attention in MS has traditionally been on T cell responses to components of the myelin sheath, evidence is emerging to suggest that non-CNS-specific antigens may play a contributory role, particularly at later stages of the disease. Among these antigens are the heat shock proteins (HSP), some members of which are known to be strongly immunogenic, conserved across the evolutionary tree, and expressed following exposure to a wide variety of stressors including heat shock and inflammatory mediators (1). Among T cell subsets thought to recognize these antigens are lymphocytes bearing the γδ T cell receptor (TCR).

γδ T cells are a minor population of peripheral blood lymphocytes whose exact function remains unclear. In this group of T cells, the repertoire of the V, D, and J region genes has been shown to be limited and junctional diversity is achieved by template and non-template-derived nucleotide insertions in the CDR3 region (2,3). In some tissues, especially in the mouse, γδ T cells have been shown to express invariant TCR gene usage, suggesting a response to highly conserved antigenic sequences (3). At birth, most γδ T cells in the peripheral blood and thymus express Vδ1; however, postnatally the Vδ2 cells expand, and in the adult Vδ2/Vγ2 (Vγ9) gene segments are expressed by >70% of circulating γδ T cells (4, 5). These Vδ2 cells also express high levels of CD45RO, a marker for memory T cells, suggesting expansion following exposure to foreign antigens or superantigens (5). Consistent with this hypothesis are the observations that Vδ2-Vγ2-expressing T cells are selectively expanded following exposure to mycobacterial antigens (68). Further studies of the γδ T cell response to mycobacteria have suggested that members of the HSP 65- and 70-kD families may represent immunodominant antigens, although selective expansion of Vδ2 cells in response to mycobacteria-associated superantigens has also been demonstrated (913). Mycobacterial HSP 65 and HSP 70 show significant sequence homology with the mammalian HSP 60 and HSP 70 families and the expression of HSP by stressed autologous host cells has implicated a role for immune responses against HSP in diseases of possible autoimmune etiology (9,14). In MS, several studies have suggested the presence of amplified reactivity to recombinant HSP and/or mycobacterial antigens (1519). The clearest data exist for responses to HSP70, where the relative frequency of HSP70-reactive T cell lines (17) or γδ T cell clones (18) was found to be significantly increased in peripheral lymphocytes from MS patients compared with healthy donors, patients with TB, and patients with other neurological diseases. γδ T cells have been localized in demyelinated MS lesions, coincident with increased immunoreactivity for several HSP, suggesting possible functional associations (20,21).

In an attempt to detect the presence of an antigen-driven response within γδ T cells in MS tissues, several groups have examined TCR gene usage by sequencing and cloning polymerase chain reaction (PCR) products. The results of these studies have shown that, while in the acute stage of the disease Vδ1+ cells accumulate in the CSF and perivascular cuffs, in more chronic stages Vδ2+ cells predominate in demyelinated lesions (2023). Cloning and sequencing of the PCR products have suggested the presence of clonal expansion in both the Vδ2-Jδ1 and Vδ2-Jδ3 populations of these cells in the lesions, and in Vδ1+ cells in the cerebrospinal fluid (2124). In our own studies, using direct sequence analysis to assess clonality within MS lesions, the Vδ2-Jδ1 response was found to be polyclonal in eight of nine MS patients, and oligoclonal in one. In contrast, a common dominant Vδ2-Jδ3 TCR sequence was found in all nine MS brain samples, whereas the response for this gene rearrangement pattern was polyclonal in three other neurological disease patients studied for control purposes (24). These data support the conclusion that at least some γδ T cells in MS lesions respond to a common antigen.

In this report, we have used the same direct sequencing technique to assess TCR gene usage in HSP 70 responsive T cell lines derived from MS patients, tuberculosis (TB) patients, and healthy controls, and have compared the results with those obtained in T cell lines responding to PPD but nonreactive to HSP 70. Since the γδ T cell responses in MS patients showed predominant usage of Vδ2-Jδ1 or Vδ2-Jδ3 (24), and since evidence of clonality within this population of cells can be most clearly defined by analysis of the δ chain gene (2), we focussed our studies on identification of these TCR rearrangement patterns.

Materials and Methods

Donors

All tissue samples and in vitro culture procedures were conducted at the 1st Clinica Neurologica, Universita La Sapienza, Rome, Italy, according to protocols approved by the human experimentation committee of that university. Blood samples were drawn from healthy subjects, patients with relapsing-remitting MS, and patients with bacteriologically or histopathologically proven, active tuberculosis. Details of the MS patients have been published previously and none had received immunosuppressive therapy for at least 3 months before entering the study (16). The treatment regimen of the TB patients included isonicotinic acid hydrazide (5 mg/kg/day), rifampin (10 mg/kg/day), ethambutol (25 mg/kg/day), and streptomycin (1 g/day for 60 days). None had associated immune deficiencies.

Antigens

Purified protein derivative (PPD) was obtained from the Statens Serum Institut, Copenhagen, Denmark. The recombinant M. tuberculosis HSP 70 was obtained from Dr. Jan van Embden (Bilthoven, The Netherlands) through the UNDP/World Bank/WHO program.

Generation of Lymphocyte Lines

Antigen-specific T cell lines were isolated and expanded as described (16). Briefly, peripheral blood mononuclear cells (PBMC) were seeded in 100 µl volumes at a density of 2 × 106 cells/ml in medium (RPMI plus 2 mM glutamine, 100 units/ml penicillin, 100 µg/ml streptomycin, and 5% heat inactivated pooled AB serum) in the presence of PPD (10 µg/ml) and expanded with 30 units/ml recombinant human IL-2 every 3–4 days for 15 days. Cultures were restimulated with antigen and 1.5 × 105 irradiated (400 grays) autologous PBMC/well every 15 days.

Proliferation Assays

T cell lines were screened for their proliferative responses to M. tuberculosis HSP 70 at the time of the third restimulation with antigen (approximately 45 days in culture). In all proliferation assays, samples of 2 × 104 cells were placed in culture in duplicate or triplicate with 1.5 × 105 irradiated autologous PBMC/well and HSP 70. After 72 hr in culture, the cells were labeled with [3H]-thymidine (0.5 µCi/well) and harvested 16 hr later. A stimulation index of >2 with a Δ cpm >500 was regarded as a positive response.

RNA and cDNA Isolation

Total RNA was extracted from at least 2 × 106 cells using the Chomczynski guanidinium-thiocyanate method. First strand cDNA was synthesized from 5 µg of total RNA in the presence of oligo-dT primers and AMV-reverse transcriptase (Perkin Elmer Cetus, Emeryville, CA, U.S.A.). PCR amplification was performed using 5 U Taq polymerase in 100 µl reaction mixture containing 10 mM Tris-HCl pH 8.3, 50 mM KCl, 2 mM MgCl2, 2% of the cDNA obtained from 5 µg of total RNA, and 1.0 mM of dATP, dCTP, dGTP, and dTTP. The cDNA amplification was performed for 30 cycles. Each cycle included denaturation at 94°C for 1 min, annealing at 55°C for 2 min and elongation at 72°C for 2 min with an extra cycle of 10 min at 72°C. Following amplification, the samples were separated on a 1% agarose gel. Twenty picomolar of each of the following primers were used: Vδ2 5′ ACCCTCAGGTGCTCCATGAA 3′; Jδ1 3′ TCCACAGTCACACGGGTTC 5′; and Jδ3 3′ TCCACGAAGAGTTTGATGCC 5′. To rule out the possibility that the nucleotide sequence that we obtained was affected by the primers used, we performed similar experiments with the following internal primers: Vδ2 5′ GCACCATCAGAGAGAGATAAGGG 3′ and Jδ3 3′ AAAACATCTGTCGGGTGTCCC 5′. Primers for β-actin were used as a positive control. The restriction site for Vδ2 was SAL-I and for Jδ1 and Jδ3 was ECO-R1. Details of primer preparation and use, including verification by sequencing and cloning the PCR products, have been reported previously (11).

Direct Sequencing

Direct sequencing was performed from the PCR product according to previously described protocols (24). DNA was purified by isopropanol precipitation to remove excess primer and the DNA was sequenced using a modified Sanger method based on asymmetrical amplification using a primer labeled with [γ32P] ATP with high specific radioactivity (5000 Ci/mmol, 10 mCi/ml) and sequencing reagents from GIBCO-BRL (Gaithersburg, MD, U.S.A.).

Results and Discussion

The results of the PCR analysis and direct sequencing are shown in Fig. 1 and Table 1. They indicate that, in freshly isolated PBMC, both Vδ2-Jδ1 and Vδ2-Jδ3 gene rearrangement patterns were detected. In contrast, in the PPD+ HSP 70+ T cell lines, the Vδ2-Jδ3 gene rearrangement pattern predominated with only one T cell line expressing both Vδ2-Jδ3 and Vδ2-Jδ1. Examples of the PCR analysis for Vδ2-Jδ1, Vδ2-Jδ3, and β-actin in the PPD+ HSP 70+ T cell lines established from one MS patient, one healthy control, and one TB patient are shown in Fig. 1A. The PCR analyses for Vδ2-Jδ1, Vδ2-Jδ3, and β-actin for freshly isolated PBMC, and PPD+ T cell lines reactive or nonreactive for HSP 70 from one healthy control are shown in Fig. 1B.

Fig. 1
figure1

PCR analysis of V δ 2-J δ 1 and V δ 2-J δ 3 in freshly isolated PBMC, or in cells cultured with PPD and selected for reactivity to HSP70

In Panel A, lanes from the left contain molecular weight markers followed by PCR analysis for Vδ2-Jδ1, Vδ2-Jδ3, and β-actin for one MS patient, one healthy control, and one TB patient, respectively, for PPD+HSP70+ T cell lines. In Panel B, lanes from the left contain molecular weight markers followed by PCR analysis for one healthy control for Vδ2-Jδ1, Vδ2-Jδ3, and β-actin for freshly isolated PBMC cultured alone, PPD+HSP70+ and PPD+HSP70 T cell lines.

Table 1 PCR and direct sequence analyses of cell lines a

To determine whether clonality occurred within the Vδ2-Jδ3 gene rearrangement patterns in these T cell lines, the PCR products were subjected to direct sequence analysis. The advantage of this sequencing strategy for TCR analysis is that conserved sequences can be observed as dominant nucleotides, distinguishable from the nucleotide diversity associated with multiple transcripts. Examples of direct sequence analyses for the Vδ2-Jδ3 PCR products are shown in Fig. 2. Analyses for the freshly isolated PBMC, and the HSP 70+ and HSP 70 T cell lines for one healthy control are shown in the upper panel of Fig. 2, and for freshly isolated PBMC and a HSP 70+ T cell line from one TB patient, and a HSP 70+ and HSP 70 T cell line from one MS patient are shown in the bottom panel of Fig. 2. As can be seen in this figure, direct sequences derived from the HSP 70+ T cell lines were remarkable for the clarity with which the sequences could be read throughout the junctional region, suggesting oligoclonality within this TCR gene population. In contrast, the direct sequences of the HSP 70 T cell lines, like the freshly isolated PBMC, became unreadable at the end of the Vδ2 sequence and the beginning of the junctional region, indicating the heterogeneity of the transcripts to be expected in, the putative CDR3 region of a polyclonal T cell population. The dominant sequences identified in the Vδ2-Jδ3 transcripts, along with the deduced amino acid sequences, are shown in Table 2. All dominant sequences were in frame, displayed portions of the Dδ3 gene segment, and predominantly used the palindromic G at the beginning of the junctional region.

Fig. 2
figure2

Direct sequence analysis of PCR products for V δ 2-J δ 3

(Upper panel) Direct sequence analyses for Vδ2-Jδ3 PCR products from one healthy control for freshly isolated PBMC, PPD+HSP70+ and PPD+HSP70 T cell lines are shown. (Lower panel) Direct sequence analyses for Vδ2-Jδ3 PCR products from one TB patient for freshly isolated PBMC and PPD+HSP70+ T cell lines, and from one MS patient for PPD+HSP70+ and PPD+HSP70 T cell lines are shown.

Table 2 Nucleotide and deduced amino acid sequences detected by direct sequencing

The dominant sequences fell into three groups. In controls 1 and 2, the oligoclonal sequences in the HSP 70+ T cell lines were different from those detected in the patients, but were identical to one another except for a small region of microheterogeneity present in the second N region between the Dδ3 and Jδ3 segments (arrows in Fig. 2, top panel). In four of four MS and two of three TB patients, the dominant Vδ2-Jδ3 sequences detected in the HSP 70+ T cell lines were identical to one another and to a dominant sequence previously detected in MS brain tissues (24). In the remaining TB patient, the oligoclonal patterns for both the HSP 70+ and HSP 70 T cell lines were different from all of the others. In the two controls, the LGDT sequence in the junctional region represents the second reading frame of Dδ3, whereas in the patients there was a shift to an abbreviated use of the third reading frame of Dδ3. Most dominant sequences also expressed the strongly hydrophobic valine at position 97 of the δ chain (25). Frequent usage of this amino acid (or less often Leu or Ile) at this position in T cells using the Vδ2 gene has been extensively documented (11,23,26,27), particularly in cells expressing Vδ2-Vγ2 gene segments. The expression of this amino acid at this position has been shown to be coded by template-independent N nucleotides and not to be due to pairing constraints (26), suggesting an antigen-driven selection process.

The preferential use of the downstream Dδ3 element in subpopulations of γδ T cells has also been noted previously. In fetal thymic and liver development, the Dδ3 gene is used almost exclusively (5,28), and repeated use of Dδ3 has been noted in Vδ2+ cells in human leishmaniasis lesions (29) and in cells cultured from jejunic and colonic biopsies from healthy individuals (30). Interestingly, in the latter study, frequent rearrangement to Jδ3 was also noted, as has been found in fetal liver γδ T cells (28). In the adult, although Vδ2 is found on the majority of peripheral blood γδ T cells, rearrangement to Jδ3 is relatively rare and Jδ1 is preferentially used. However, it has been noted that peripheral blood Vδ2 junctions often display greater usage of both Dδ3 and Jδ3, and fewer N nucleotide incorporations than Vδ1 expressing T cells (2,3).

The above results support the conclusion that HSP 70 selects for an oligoclonal response within the Vδ2-Jδ3 population, but whether this represents direct responsiveness to HSP 70 cannot be determined from the present culture conditions. Although some studies have documented a proliferative response of γδ T cells to HSP (9,18), others have suggested that these cells expand in response to activation markers or growth factors associated with T or B cell responses, as for example in the polyclonal activation of Vδ1+ cells to EBV-transformed or activated B cells (31). However, the results of the direct sequencing technique provide compelling evidence for a specific selection process in cells responding to HSP 70. Whereas the sequences in the freshly isolated PBMC or PPD+ HSP 70 Vδ2-Jδ3 population became unreadable at the end of Vδ2, indicating the variability to be expected in the junctional region, HSP 70+ T cell lines expressed a dominant sequence that was clearly readable throughout the V-D-J region. Oligoclonal expansion of γδ T cells has been noted in a number of pathologic conditions including skin lesions in patients with sarcoidosis (32), leprosy (33), and American leishmaniasis (29); in the joints of patients with rheumatoid arthritis (34), in MS lesions (21,22,24), and in one case of polymyositis in which, like our present findings, there was an oligoclonal response in a Vδ2-Jδ3 population (35). Interestingly, frequent exclusive recombination of Vδ2 and Dδ3 was also noted in some of these tissues (24,34,35). Although evidence of clonality within the peripheral blood population was not noted in many of these studies, a tendency towards oligoclonality within both the Vδ2 and Vδ1 populations has been noted in association with normal aging (36).

A particularly surprising outcome of our studies was the observation that the sequence in four of four MS patients and two of three TB patients was identical to that found in this same subset of γδ T cells in MS lesions. These data suggest that in certain chronic inflammatory diseases, an epitope of HSP 70 selects for a specific subpopulation of γδ T cells, and supports the conclusion that in MS lesions these cells are responding to HSP 70. Although we can only speculate on the potential relevance of this observation to lesion development, γδ T cells are known to possess potent cytotoxic activity and have been demonstrated to kill oligodendrocytes in vitro (37). Alternatively, interaction of γδ T cells with HSP 70 could function in an immunoregulatory pathway following expression of HSP 70 on the surface of inflammatory cells (38). In active MS lesions, immunoreactivity for HSP has been found on inflammatory cells in the perivascular cuffs and on glial cells at the edge of the lesion (20,21), and cytokines have been shown to upregulate HSP 70 on glial cells in vitro (39). Furthermore, a particular polymorphism of HSP 70 has recently been associated with cellular reactivity to HSP 70 in patients with MS (40). HSP 70 is known to be an immunodominant antigen that contains many stimulatory epitopes. Ongoing studies will determine whether the different oligoclonal sequences detected in the patient and control sample groups represent responses to different epitopes of HSP 70 and whether these reside within conserved or nonconserved regions of the protein.

References

  1. 1.

    Georgopoulos C, McFarland H. (1993) Heat shock proteins in multiple sclerosis and other autoimmune diseases. Immunol Today 14: 373–375.

    Article  CAS  PubMed  Google Scholar 

  2. 2.

    Porcelli S, Brenner MR, Band H. (1991) Biology of the human γδ T-cell receptor. Immunol Rev. 120: 137–183.

    Article  CAS  PubMed  Google Scholar 

  3. 3.

    Haas W, Pereira P, Tonegawa S. (1993) Gamma/delta T cells. Annu. Rev. Immunol 11: 637–685.

    Article  CAS  PubMed  Google Scholar 

  4. 4.

    De Libero G, Casorati G, Giachino C, et al. (1991) Selection by two powerful antigens may account for the presence of the major population of human peripheral gamma-delta T cells. J. Exp. Med. 173: 1311–1322.

    Article  PubMed  Google Scholar 

  5. 5.

    Parker CM, Groh V, Band H, et al. (1990) Evidence for extrathymic changes in the T cell receptor γδ repertoire. J. Exp. Med. 171: 1597–1612.

    Article  CAS  PubMed  Google Scholar 

  6. 6.

    Modlin RL, Pirmez C, Hofman FM, et al. (1989) Lymphocytes bearing antigen-specific γδ T-cell receptors accumulate in human infectious disease lesions. Nature 338: 544–548.

    Article  Google Scholar 

  7. 7.

    Janis EM, Kaufman SHE, Schwartz RH, Pardoll DM. (1989) Activation of γδ T cells in the primary immune response to Mycobacterium tuberculosis. Science 244: 713–716.

    Article  CAS  PubMed  Google Scholar 

  8. 8.

    Kabelitz D, Bender A, Prospero T, Wesselborg S, Jannsen O, Pechhold K. (1991) The primary response of human γδ+ T cells to Mycobacterium tuberculosis is restricted to Vγ9 bearing cells. J. Exp. Med. 173: 1331–1338.

    Article  CAS  PubMed  Google Scholar 

  9. 9.

    Haregewoin A, Soman G, Hom RC, Finberg RW. (1989) Human γδ T cells respond to mycobacterial heat shock protein. Nature 340: 309–312.

    Article  CAS  PubMed  Google Scholar 

  10. 10.

    O’Brien RL, Happ MP, Dallas A, Palmer E, Kubo R, Born WK. (1989) Stimulation of a major subset of lymphocytes expressing T cell receptor gamma delta by an antigen derived from Mycobacterium tuberculosis. Cell 57: 667–674.

    Article  PubMed  Google Scholar 

  11. 11.

    Ohmen J, Barnes PF, Uyemura K, Lu S, Grisso CL, Modlin RL. (1991) The T cell receptors of human γδ T cells reactive to Mycobacterium tuberculosis are encoded by specific V genes but diverse V-J junctions. J. Immunol. 147: 3353–3359.

    PubMed  CAS  Google Scholar 

  12. 12.

    Pfeffer K, Schoel B, Plesnila N, et al. (1992) A lectin-binding, protease-resistant, mycobacterial ligand specifically activates Vγ9+ human γδ T cells. J. Immunol. 148: 575–583.

    PubMed  CAS  Google Scholar 

  13. 13.

    Tanaka Y, Sano S, Nieves E, et al. (1994) Non-peptide ligands for γδ T cells. Proc. Natl. Acad. Sci. U.S.A. 91: 8175–8179.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  14. 14.

    Rajasekar R, Sim G-K, Augustin A. (1990) Self heat shock and γδ T cell reactivity. Proc. Natl. Acad. Sci. U.S.A. 87: 1767–1771.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  15. 15.

    Birnbaum G, Kotilinek L, Albrecht L. (1993) Spinal fluid lymphocytes from a subgroup of multiple sclerosis patients respond to mycobacterial antigens. Ann. Neurol. 34: 18–24.

    Article  CAS  PubMed  Google Scholar 

  16. 16.

    Salvetti M, Buttinelli C, Ristori G, et al. (1992) T lymphocyte reactivity to the mycobacterial 65- and 70-kDa heat shock proteins in multiple sclerosis. J. Autoimmun. 5: 691–702.

    Article  CAS  PubMed  Google Scholar 

  17. 17.

    Salvetti M, Ristori G, Buttinelli C, et al. (1994) T Lymphocyte response to 70-kD heat shock proteins in multiple sclerosis, in tuberculosis and in healthy individuals. J. Neuroimmunol. 54: 193A.

    Article  Google Scholar 

  18. 18.

    Stinissen P, Vandevyer C, Medaer R, et al. (1995) Increased frequency of γδ T cells in CSF and peripheral blood of MS patients: Reactivity, cytotoxicity and T cell receptor V gene rearrangements. J. Immunol. 154: 4883–4894.

    PubMed  CAS  Google Scholar 

  19. 19.

    van Noort JM, van Sechel AC, El Ouagmiri M, Bajramovic J, Polman CH, Ravid R. (1994) A small heat shock protein serves as immunodominant T-cell antigen in MS-affected human myelin. J. Neuroimmunol. 54: 194A.

    Google Scholar 

  20. 20.

    Selmaj K, Brosnan CF, Raine CS. (1991) Co-localization of lymphocytes bearing γδ T-cell receptor and heat shock protein hsp65+ oligodendrocytes in multiple sclerosis. Proc. Natl. Acad. Sci. U.S.A. 88: 6452–6456.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  21. 21.

    Wucherpfennig KW, Newcombe J, Li H, Keddy C, Cuzner ML, Hafler DA. (1992) γδ T-cell receptor repertoire in acute multiple sclerosis lesions. Proc. Natl. Acad. Sci. U.S.A. 89: 4588–4592.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  22. 22.

    Shimonkevitz R, Colburn C, Burnham JA, Murray RS, Kotzin BL. (1993) Clonal expansion of activated γ/δ T cells in recent onset multiple sclerosis. Proc. Natl. Acad. Sci. U.S.A. 90: 923–927.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  23. 23.

    Hvas J, Oksenberg JR, Fernando R, Steinman L, Bernard CCA. (1993) γδ T cell receptor repertoire in brain lesions of patients with multiple sclerosis. J. Neuroimmunol. 46: 225–234.

    Article  CAS  PubMed  Google Scholar 

  24. 24.

    Battistini L, Selmaj K, Kowal C, et al. (1995) Multiple sclerosis: Limited diversity of the Vδ2-Jδ3 T-cell receptor in chronic active lesions. Ann. Neurol. 37: 198–203.

    Article  CAS  PubMed  Google Scholar 

  25. 25.

    Triebel F, Faure F, Mami-Chouaib F, et al. (1988) A novel Vδ gene expressed predominantly in the TiγA fraction of γ/δ+ peripheral lymphocytes. Eur. J. Immunol. 18: 2021–2027.

    Article  CAS  PubMed  Google Scholar 

  26. 26.

    Davodeau F, Peyrat MA, Hallet MM, Houde I, Vie H, Bonneville M. (1993) Peripheral selection of antigen receptor junctional features in a major human γδ subset. Eur. J. Immunol. 23: 804–808.

    Article  CAS  PubMed  Google Scholar 

  27. 27.

    Breit TM, Wolvers-Tettero ILM, van Dongen JM. (1994) Unique selection determinant in polyclonal Vδ2-Jδ1 junctional regions of human peripheral γδ T lymphocytes. J. Immunol 152: 2860–2864.

    PubMed  CAS  Google Scholar 

  28. 28.

    Wucherpfennig KW, Liao YJ, Prendergast M, Prendergast J, Hafler DA, Strominger JL. (1993) Human fetal liver γδ T cells predominantly use unusual rearrangements of the T cell receptor δ and γ loci expressed on both CD4+ and CD8− and CD4−CD8− γδ T cells. J. Exp. Med. 177: 425–432.

    Article  CAS  PubMed  Google Scholar 

  29. 29.

    Uyemura K, Klotz J, Pirmez C, et al. (1992) Microanatomic clonality of γδ T cells in human Leishmaniasis lesions. J. Immunol. 148: 1205–1211.

    PubMed  CAS  Google Scholar 

  30. 30.

    Robijn RJ, Bloemendal H, Jainandunsing S, et al. (1993) Phenotypic and molecular characteristics of human monoclonal TCRγδ T cell-lines from jejunum and colon of healthy individuals. Scand. J. Immunol. 38: 247–253.

    Article  CAS  PubMed  Google Scholar 

  31. 31.

    Orsini DLM, van Gils M, Kooy YMC, et al. (1994) Functional and molecular characterization of B cell-responsive Vδ1 + γδ T cells. Eur. J. Immunol 24: 3199–3204.

    Article  CAS  PubMed  Google Scholar 

  32. 32.

    Tamura N, Holroyd KJ, Banks T, Kirby M, Okayama H, Crystal RG. (1990) Diversity in junctional sequences associated with the common human Vδ9 and Vδ2 gene segments in normal blood and lung compared with the limited diversity in a granulomatous disease. J. Exp. Med. 172: 169–181.

    Article  CAS  PubMed  Google Scholar 

  33. 33.

    Uyemura K, Deans RJ, Band H, et al. (1991) Evidence for clonal selection of γ/δ T cells in response to a human pathogen. J. Exp. Med. 174: 683–692.

    Article  CAS  PubMed  Google Scholar 

  34. 34.

    Olive C, Gatenby PA, Serjeantson S. (1992) Variable gene usage of T cell receptor γ and δ-chain transcripts expressed in synovia and peripheral blood of patients with rheumatoid arthritis. Clin. Exp. Immuol. 87: 172–177.

    Article  CAS  Google Scholar 

  35. 35.

    Pluschke G, Ruegg D, Hohlfeld R, Engel AG. (1992) Autoaggressive myocytotoxic T lymphocytes expressing an unusual gamma/delta T cell receptor. J. Exp. Med. 176: 1785–1789.

    Article  CAS  PubMed  Google Scholar 

  36. 36.

    Giachino C, Granziero L, Modena V, et al. (1994) Clonal expansion of Vδ1+ and Vδ2+ cells increase with age and limit the repertoire of human γδ T cells. Eur. J. Immunol 24: 1914–1918.

    Article  CAS  PubMed  Google Scholar 

  37. 37.

    Freedman MS, Ruijs TCG, Selin LK, Antel JP. (1991) Peripheral blood gamma-delta T cells lyse fresh human brain-derived oligodendrocytes. Ann. Neurol. 30: 794–800.

    Article  CAS  PubMed  Google Scholar 

  38. 38.

    Janeway CA, Jones B, Hayday A. (1988) Specificity and function of T cells bearing γ/δ receptors. Immunol. Today 9: 73–76.

    Article  PubMed  Google Scholar 

  39. 39.

    D’Souza SD, Antel JP, Freedman MS. (1994) Cytokine induction of heat shock protein expression in human oligodendrocytes: An interleukin-1-mediated mechanism. J. Neuroimmunol 50: 17–24.

    Article  PubMed  Google Scholar 

  40. 40.

    Freedman MS, Abiscott J, Goldstein R. HSP70 gene polymorphism correlates with cellular reactivity to HSP in multiple sclerosis. Neurology (1995) 45: A467.

    Article  Google Scholar 

Download references

Acknowledgments

Supported in part by USPHS Grants NS 11920 and NS 08952, and RG 1001-H-8 and FA 1095 from the National Multiple Sclerosis Society, the New York Community Trust and the Gladstein Foundation; and by grants from the Italian Multiple Sclerosis Society (AISM) and the Istituto Mediterraneo per la Ricerca Scientifica, Pozzilli, Italy. Presented in part at the IVth International Congress of Neuroimmunology, Amsterdam, The Netherlands, 1994.

Author information

Affiliations

Authors

Corresponding author

Correspondence to Celia F. Brosnan.

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Battistini, L., Salvetti, M., Ristori, G. et al. γδ T Cell Receptor Analysis Supports a Role for HSP 70 Selection of Lymphocytes in Multiple Sclerosis Lesions. Mol Med 1, 554–562 (1995). https://doi.org/10.1007/BF03401592

Download citation